Bienvenido
 
Asociacion Cientifica de Criminologia
Navega  
  INICIO
  Origen de la Criminologia
  Iniciar Sesion
  Estatutos ACC
  Videos
  Google Earth
  Imagenes
  Eventos
  Archivos
  => Campo Laboral
  => El Poligrafo o Detector de Mentiras
  => IBIS
  => Criminalistica
  => Nuevo avance en huellas digitales
  => El arte de la investigacion criminal
  => Importancia de la prueba de ADN
  => Sistamos Automatizados de Identificacion de Huellas Dactilares (AFIS)
  => La criminología: el negocio y la quiebra
  => Entomologia Forense: los Insectos en la Esena del Crimen
  => Cibercrimen
  => Tipos de Sangre
  => Utilidad y Valoracion del Dictamen Pericial
  => Los Mejores Venenos Mortales, Ingeridos o Inalados
  => El lugar de los hechos y los indicios biologicos: recogida, almacenamiento y envio al laboratorio
  => Importancia del indicio y del lugar de los hechos
  => Tipos de Camaras
  Links
  Foro
  Bolsa de trabajo
  Practicas profesionales
  Plan de estudios FACDYC
  Temarios FACDYC
  Cursos y Diplomados
  Alumnos FACDYC (Tareas)
  Seminario de Criminología 2008
  Biblioteca Virtual
  .CONTACTO.
  Reglamentos y Leyes
Importancia del indicio y del lugar de los hechos
Importancia del indicio y del lugar de los hechos

 

 

INTRODUCCIÓN:

El desarrollo social ha traído consigo una modificación de la tipología delictiva, que ha hecho relativamente frecuentes determinados tipos de actos criminales caracterizados por su violencia con una notable desproporción de fuerzas entre víctima y agresor y por la utilización de instrumentos y armas que hacen que las evidencias o indicios dejados en el lugar de los hechos por el autor o autores sean mínimas. Paralelamente, el desarrollo científico ha posibilitado la aplicación de nuevas tecnologías que han ido profundizando en su capacidad identificadora sobre indicios cada vez más pequeños; el máximo exponente en el momento actual es la denominada tecnología del ADN.

Hablar hoy día del ADN en el campo de la Medicina Forense no resulta desconocido, ni siquiera novedoso. Desde su primera aplicación en Inglaterra por parte de Alec Jeffreys en el año 1985 para la resolución de un caso de inmigración de un joven procedente de Ghana, y, sobre todo, su posterior aplicación dos años más tarde, a la investigación criminal, posibilitando identificar a Robert Melias, un peón de Bristol de 32 años de edad, como autor de una agresión sexual a una mujer enferma de polio, y a Nigel Davis como autor del denominado "caso del condado de Leicestershire", en el que se produjo la violación y muerte de dos mujeres del condado, la primera en 1983 y la segunda en 1985 y donde los métodos serológicos clásicos no pudieron lograr una individualización suficiente con los indicios biológicos obtenidos de las víctimas, su uso se ha extendido y generalizado a una velocidad sólo comprensible y justificable por la efectividad y versatilidad de esta tecnología. Esta aceptación general ha conllevado un desarrollo que ha obligado a una notable evolución de la técnicas aplicables en la identificación forense y así en el breve periodo de tiempo de 10 años hemos pasado de sólo poder estudiar determinados fragmentos del ADN de una longitud relativamente grande a analizar pequeñas regiones procedentes de indicios mínimos por medio de su amplificación mediante la reacción en cadena de la polimerasa (PCR). Todo ello ha supuesto una importante modificación tanto en lo cuantitativo como en lo cualitativo de los indicios biológicos.

Sin embargo, para que de los indicios biológicos -que por definición son únicos, pequeños y frágiles- se pueda obtener información genética que conduzca a la identificación de personas, los procesos de recogida, almacenamiento y envío de dichos indicios o restos biológicos debe de ser extremadamente cuidadosa, siguiendo unas pautas sencillas y claramente preestablecidas. Si el Médico Forense no es consciente de esto, de que pueden existir estas muestras y de cómo hay que recogerlas, mantenerlas y enviarlas, las evidencias se perderán, se degradarán o se contaminarán, invalidando cualquier investigación posterior y privando a la Administración de Justicia en particular y a la sociedad en general, de datos que permitan esclarecer este tipo de hechos, que no por ser cada vez más frecuentes dejan de ser reprobables.

La regulación sobre recogida de muestras y concretamente la OM de junio de 1987 son muy generales y a pesar de su utilidad no incluyen normas específicas para la recogida de indicios destinados al análisis del ADN, hecho, por otra parte lógico por su proximidad al inicio de la aplicación de esta técnica. Con posterioridad se han dado normas específicas en este sentido, haciendo hincapié en algunos tipos delictivos que por sus especiales características en relación a la gravedad y trascendencia de los mismos y a la presencia casi constante de indicios biológicos, deben ser estudiados más detenidamente y enfocando la investigación para la obtención de la evidencias señaladas, nos referimos fundamentalmente a las agresiones sexuales y muy especialmente a la violación.


A pesar de estas iniciativas creemos que es insuficiente para la realización de una correcta investigación médico-legal la simple aplicación de una serie de normas o protocolos con el fundamento "del deber hacerlo de ese modo". Es necesario que el Médico Forense tenga una visión y concepto integral del indicio en el proceso de la investigación biológica del mismo, sabiendo la importancia del mismo en cada una de las fases de la investigación criminal y las posibilidades técnicas actuales en los laboratorios de referencia, así como un conocimiento del papel que debe desempeñar para la buena marcha de la investigación y la consecución del objetivo final: la identificación de una perfil genético con unas características óptimas para su utilización y valoración en el proceso judicial.



BASES BIOMOLECULARES DEL ESTUDIO DEL ADN EN MEDICINA FORENSE.


El ADN es un polinucleótido constituido por dos cadenas antiparalelas de unidades de desoxirribonucleótidos unidos covalentemente, dispuestos de una forma complementaria y adoptando una estructura enrollada de doble hélice dextrógira. Las bases que forma los nucleótidos son la adenina (A), guanina (G), citosina (C) y timina (T).

Su estructura fue descubierta por James WATSON y Francis CRICK en 1953, lo cual permitió afrontar su estudio de forma directa, evitando los dificultosos y complejos caminos indirectos que se habían utilizado hasta entonces.

Basándonos en la función del ADN podemos dividirlo en dos grandes grupos:

1.- ADN CODIFICANTE O ESENCIAL.

Es el encargado de almacenar la información genética en los genes, que son los diferentes sectores de ADN con un orden concreto en la disposición de los nucleótidos que determina la secuencia de aminoácidos de las proteínas que codifican y el grado de expresión del gen en cada tejido y en cada tiempo. Esta función del ADN se corresponde con la idea generalizada que se tiene sobre el mismo.

2.- ADN NO CODIFICANTE.

No obstante, existe otra parte del ADN cuya función específica es desconocida en la actualidad, aunque se sabe que no guarda información genética y que juega un importante papel en la estructura y en la función de los cromosomas y, sobre todo, actuando como puntos calientes de recombinación.

Este ADN puede ser de dos tipos: ADN espaciador, el cual está formado por una secuencia sencilla de bases que se dispone entre regiones codificantes del genoma; y ADN repetitivo, que lo forma una secuencia que, al contrario que el espaciador, se dispone por todo el genoma debido a la existencia de múltiples copias. A su vez este ADN repetitivo se divide según las características de la secuencia en "Secuencias repetidas en tándem", en las que existe una secuencia común relativamente corta que se repite en tándem de manera continua (una tras otra) en un fragmento de ADN


---- ATCGG ATCGG ATCGG ATCGG ATCGG ----


y "Secuencias repetidas intercaladas", tratándose de una secuencia larga de bases que aparece repetida, pero no a continuación del primer grupo de secuencia repetitivo, sino en un lugar diferente y distante del genoma:


------- ATCCCCGGGAATCGATAAACGGATC ----------------------- ATCCCCGGGAATCGATAAACGGATC ------


Las características generales del ADN no codificante lo hacen especialmente útil para su aplicación a la identificación en Medicina Forense. Como se puede deducir de su trascendente función, el ADN esencial está formado por secuencias altamente conservadas con muy pocas variaciones interindividuales e intergeneracionales, ya que de lo contrario se podrían ver afectadas funciones básicas para la vida de las personas. Los mínimos cambios que tienen lugar, cuando son viables, aumentan el polimorfismo de proteínas y enzimas, aunque también pueden tener efectos negativos.

Por el contrario, el ADN no codificante presenta una gran variabilidad de unos individuos a otros, ya que estas secuencia no son conservadoras al no afectar sus cambios a la fisiología del individuo. Las variaciones debidas a cambios de bases sencillos, procesos de inserción-delección o de intercambio de ADN (recombinación) durante la formación de las células germinales (meiosis), hacen que se modifiquen el número de repeticiones o el orden de las bases de un determinado fragmento repetitivo, pudiendo producirse en un locus sencillo o e múltiples loci, siendo este el origen de la variación que hace que no haya dos personas, a excepción de los gemelos univitelinos, que tengan la misma secuencia del ADN.

La repercusión práctica de lo anterior es la existencia de diferentes alelos, es decir la posibilidad de que encontremos entre la población varias formas de presentarse un determinado carácter o fragmento de ADN no codificante.

Los métodos más extendidos y de común aplicación en Medicina Forense para estudiar el ADN son:


1.- HIBRIDACIÓN CON SONDAS.

Básicamente consiste en la identificación de una región determinada mediante el uso de una sonda, que es un fragmento monocatenario de ADN complementario a una secuencia de bases conocida. Esta sonda, marcada con un producto radiactivo o quimioluminescente, se pone en la solución con el ADN de la muestra y se visualiza después de una serie de procesos para separar los diferentes alelos que puedan existir con base en la longitud de los mismos.


2.- REACCIÓN EN CADENA DE LA POLIMERASA (PCR).

Esta técnica supuso una verdadera revolución y es la más extendida en la actualidad, por sí sola o como paso intermedio de la secuenciación. Inventada por Kary MULLIS en 1987, le supuso el premio Nobel de Química el pasado año.

Gracias a esta técnica se puede amplificar una determinada región del ADN que está delimitada por una secuencia específica y complementaria a unas pequeñas sondas denominadas primers que actúan como iniciadores de la reacción de polimerización que lleva a cabo una enzima, habitualmente la Taq polimerasa. Esta enzima va uniendo desoxinucleótidos, que nosotros incluimos en la reacción, de forma complementaria a cada una de los fragmentos de las cadenas que se delimitan por los primers que son tomadas como moldes. La repetición cíclica de este proceso permite la obtención de múltiples copias de dicha región en una cantidad suficiente para ser estudiada. Posteriormente, el ADN amplificado se puede visualizar mediante la separación de los alelos de diferente tamaño y tinción o estudiando las variaciones de su secuencia.

De este modo es posible que cuando dispongamos de muy escasa cantidad de ADN en un indicio o esté parcialmene degradado, sea posible amplificarlo y obtener una cantidad suficiente para su análisis.


3.- SECUENCIACIÓN.

Las técnicas de este grupo van destinadas a revelar el orden de la secuencia de bases de una determinada región, normalmente delimitada previamente por PCR. Puede hacerse de forma manual o automática.

En Medicina Forense se aplica, fundamentalmente, para el análisis del ADN mitocondrial por sus especiales características.

En todos los casos es necesario que exista polimorfismo, es decir, que el fragmento o secuencia que vamos a estudiar sea polimórfico, lo que básicamente podemos entender como variabilidad, o sea que se presente de formas diferentes, ya que de lo contrario no podremos identificar a los individuos.

Todo lo anterior nos lleva a destacar dos grandes aspectos de la investigación del ADN en nuestra especialidad:

1.- Se trata de ADN no codificante, es decir, que la información obtenida tras su análisis no nos puede aportar nada sobre ninguna de las características fenotípicas del individuo. No obstante, conforme van avanzando las investigaciones sobre el Proyecto Genoma Humano se van descubriendo que parte del ADN no codificante está relacionado con alguna característica fenotípica, bien de tipo fisiológico o bien patológico (enfermedades). En cualquier caso en la mayoría de los casos la información es poco significativa desde el punto de vista práctico, tratándose más de un interés científico.

2.- Al igual que en tantos otros métodos de identificación médico-forense, es necesario llevar a cabo una comparación entre el perfil genético obtenido del indicio o muestra y el genotipo de un individuo o evidencia orgánica.
Usuarios  
 
Nombre de usuario:
Contraseña:
 
Publicidad  
   
Info  
  Facultad de Derecho y Criminologia
Universidad Autonoma de Nuevo Leon

Dactiloscopia
Transito Terrestre
Criminologia
Criminalistica
Sistemas de Identificacion
Medicina Forense
 
Contacto  
  Te gustaria formar parte de ACC
Recibir info de eventos
Dudas?
Envianos tus Trabajos, Articulos, etc... para que sean publicados aqui .

criminologiaac@hotmail.com

 
Afiliados  
  Instituto de Investigaciones Forenses (IIF)
Sociedad Mexicana de Criminologia Capitulo Nuevo Leon A.C. (SOMECRIMNL)
Asociacion Cientifica Gallega de Criminologia (ACGC)
Colegio de Especialistas Forenses A.C. (COESFO)
 
45741 visitantes
=> ¿Desea una página web gratis? Pues, haz clic aquí! <=